WormMine: Gene WBGene00026161

• WormBase Gene ID: WBGene00026161
• Gene Name: Cbr-jun-1
• Sequence Name: CBG03270
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity and DNA-binding transcription factor activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans jun-1. In C. elegans, jun-1 is involved in several processes, including determination of adult lifespan; positive regulation of RNA splicing; and response to starvation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03270b.1	CBG03270b.1		[unknown]
Transcript:CBG03270a.1	CBG03270a.1		[unknown]
Transcript:CBG03270c.1	CBG03270c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03270c	CBG03270c		[unknown]
CDS:CBG03270b	CBG03270b		[unknown]
CDS:CBG03270a	CBG03270a		[unknown]

0 RNAi Result

3 Allele

• WBVar00141980
• WBVar00108238
• WBVar00108237

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061879
• Remark: CBG03270, GCCAACTTCCGTCAAATGGTGGAACGTCATTCGAACACCGGATGTCCAAATAACTCGATT, WBGene00026161
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region