WormMine: Gene WBGene00026194

• WormBase Gene ID: WBGene00026194
• Gene Name: Cbr-klp-3
• Sequence Name: CBG03312
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; microtubule binding activity; and microtubule motor activity. Predicted to be involved in microtubule-based movement. Is an ortholog of C. elegans klp-3. In C. elegans, klp-3 is involved in chromosome separation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03312a.1	CBG03312a.1		[unknown]
Transcript:CBG03312c.1	CBG03312c.1		[unknown]
Transcript:CBG03312b.1	CBG03312b.1		[unknown]
Transcript:CBG03312d.1	CBG03312d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03312d	CBG03312d		[unknown]
CDS:CBG03312c	CBG03312c		[unknown]
CDS:CBG03312b	CBG03312b		[unknown]
CDS:CBG03312a	CBG03312a		[unknown]

0 RNAi Result

3 Allele

• WBVar00108259
• WBVar00108258
• WBVar00108260

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063853
• Remark: Cbr-klp-3, TTGGTGGATCTTGCTGGATCCGAAAGAGTATCACAAACAAATGCAACCGGACAATTGCTC, WBGene00026194
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region