WormMine: Gene WBGene00026306

• WormBase Gene ID: WBGene00026306
• Gene Name: Cbr-uba-1
• Sequence Name: CBG03440
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ubiquitin-like modifier activating enzyme activity. Predicted to be involved in protein modification process. Is an ortholog of C. elegans uba-1. In C. elegans, uba-1 is involved in several processes, including developmental process involved in reproduction; negative regulation of transcription by RNA polymerase II; and programmed cell death involved in cell development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03440.1	CBG03440.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03440	CBG03440		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_downregulated
	C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1051359
• Remark: Cbr-uba-1, GTGCCTTCTTTTCTCGTTCTTTATGAATGGCGCTAAGAAAGAAGAGAGACTCAAGACTGA, WBGene00026306
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region