WormMine: Gene WBGene00026308

• WormBase Gene ID: WBGene00026308
• Gene Name: Cbr-rrp-1
• Sequence Name: CBG03442
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in rRNA processing. Predicted to be part of preribosome, small subunit precursor. Is an ortholog of C. elegans rrp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03442.2	CBG03442.2		[unknown]
Transcript:CBG03442.1	CBG03442.1		[unknown]
Transcript:CBG03442.4	CBG03442.4		[unknown]
Transcript:CBG03442.3	CBG03442.3		[unknown]
Transcript:CBG03442.6	CBG03442.6		[unknown]
Transcript:CBG03442.5	CBG03442.5		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03442	CBG03442		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050365
• Remark: CBG03442, GCTCATCTTGCCGGTTTGAAATGGAAGAAAGAGATTCGTGATCAGTATTGGAACGTTTTC, WBGene00026308
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region