WormMine: Gene WBGene00026344

• WormBase Gene ID: WBGene00026344
• Gene Name: Cbr-vha-7
• Sequence Name: CBG03483
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable proton-transporting ATPase activity, rotational mechanism. Predicted to be involved in proton transmembrane transport. Predicted to be part of vacuolar proton-transporting V-type ATPase, V0 domain. Is an ortholog of C. elegans vha-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03483b.1	CBG03483b.1		[unknown]
Transcript:CBG03483a.1	CBG03483a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03483a	CBG03483a		[unknown]
CDS:CBG03483b	CBG03483b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067157
• Remark: Cbr-vha-7, GAATTCCAATCAAAGTTCTACCTGGGAACCGGACATCCATTCCACGCATTTTATCTCAAA, WBGene00026344
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region