WormMine: Gene WBGene00026360

• WormBase Gene ID: WBGene00026360
• Gene Name: Cbr-dgk-4
• Sequence Name: CBG03505
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP-dependent diacylglycerol kinase activity. Predicted to be involved in protein kinase C-activating G protein-coupled receptor signaling pathway. Is an ortholog of C. elegans dgk-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03505b.1	CBG03505b.1		[unknown]
Transcript:CBG03505d.1	CBG03505d.1		[unknown]
Transcript:CBG03505c.1	CBG03505c.1		[unknown]
Transcript:CBG03505a.1	CBG03505a.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03505c	CBG03505c		[unknown]
CDS:CBG03505d	CBG03505d		[unknown]
CDS:CBG03505a	CBG03505a		[unknown]
CDS:CBG03505b	CBG03505b		[unknown]

0 RNAi Result

45 Allele

• WBVar00142036
• WBVar00108416
• WBVar00108415
• WBVar00108414
• WBVar00108413
• WBVar00108412
• WBVar00108411
• WBVar00108410
• WBVar00108409
• WBVar00108426
• WBVar00108425
• WBVar00108424
• WBVar00108423
• WBVar00108422
• WBVar00108421
• WBVar00108420
• WBVar00108419
• WBVar00108418
• WBVar00108417
• WBVar00047394
• WBVar00047399
• WBVar00047424
• WBVar00047429
• WBVar00047434
• WBVar00047439
• WBVar00047454
• WBVar00047444
• WBVar00047449
• WBVar00047459
• WBVar00047409

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060517
• Remark: Cbr-dgk-4, GCTCATCGAGGGGGAGATCGCTCGGCTTGGAGTGTCTTCGGCGTTCCTGGGGTCCCTGGA, WBGene00026360
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region