WormMine: Gene WBGene00026402

• WormBase Gene ID: WBGene00026402
• Gene Name: Cbr-tpst-1
• Sequence Name: CBG03560
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein-tyrosine sulfotransferase activity. Is an ortholog of C. elegans tpst-1. In C. elegans, tpst-1 is involved in several processes, including collagen metabolic process; cuticle development involved in collagen and cuticulin-based cuticle molting cycle; and regulation of nematode larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03560.1	CBG03560.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03560	CBG03560		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1067366
• Remark: Cbr-tpst-1, TACAAAAAAGCGGTCCAAGTGGTCAACGATCCCGAACGAGTCGACAAACCGATAGTGGAC, WBGene00026402
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region