WormMine: Gene WBGene00026410

• WormBase Gene ID: WBGene00026410
• Gene Name: Cbr-unc-64
• Sequence Name: CBG03570
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in vesicle-mediated transport. Predicted to be located in membrane. Is an ortholog of C. elegans unc-64. In C. elegans, unc-64 is involved in several processes, including chemical synaptic transmission; positive regulation of anterior/posterior axon guidance; and ventral cord development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03570.1	CBG03570.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03570	CBG03570		[unknown]

0 RNAi Result

3 Allele

• WBVar00108441
• WBVar00108443
• WBVar00108442

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064062
• Remark: Cbr-unc-64, GAAGGAATTCGTCGACCGCGCCGTCGCCGATACCAAGAAAGCCGTGCAATACCAGTCGAA, WBGene00026410
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region