WormMine: Gene WBGene00026444

• WormBase Gene ID: WBGene00026444
• Gene Name: Cbr-brc-1
• Sequence Name: CBG03614
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metal ion binding activity. Predicted to be involved in DNA repair. Is an ortholog of C. elegans brc-1. In C. elegans, brc-1 is involved in several processes, including DNA repair; cellular response to ionizing radiation; and nuclear chromosome segregation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03614a.1	CBG03614a.1		[unknown]
Transcript:CBG03614b.1	CBG03614b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03614b	CBG03614b		[unknown]
CDS:CBG03614a	CBG03614a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069424
• Remark: Cbr-brc-1, TACAACTGTCAAGTGCTCACAATGGAATGGGTTTTGGATAGTATCAGCGAGTATTCGAGA, WBGene00026444
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region