WormMine: Gene WBGene00026482

• WormBase Gene ID: WBGene00026482
• Gene Name: Cbr-lat-2
• Sequence Name: CBG03673
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled receptor activity and carbohydrate binding activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans lat-2. In C. elegans, lat-2 is involved in self proteolysis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03673.1	CBG03673.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03673	CBG03673		[unknown]

0 RNAi Result

11 Allele

• WBVar00108713
• WBVar00108712
• WBVar00108711
• WBVar00108710
• WBVar00108709
• WBVar00108708
• WBVar00108707
• WBVar00108706
• WBVar00108705
• WBVar00108714
• WBVar00018769

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050794
• Remark: Cbr-lat-2, TCAATCCCGTGATCGTACAAAATGGGGAAGAATCATCGGATGGCTAAAAGGATCTGCGAC, WBGene00026482
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region