WormMine: Gene WBGene00026554

• WormBase Gene ID: WBGene00026554
• Gene Name: CBG03761
• Sequence Name: CBG03761
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; mRNA 5'-triphosphate monophosphatase activity; and mRNA guanylyltransferase activity. Predicted to be involved in 7-methylguanosine mRNA capping. Is an ortholog of C. elegans cel-1. In C. elegans, cel-1 is involved in polynucleotide 5' dephosphorylation and positive regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03761.1	CBG03761.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03761	CBG03761		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055302
• Remark: Cbr-cel-1, TACTGATAAATCTCTTCCCAACGGACTGCGAACTGCTCAAAATGTTTTGGACACAATGCT, WBGene00026504
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region