WormMine: Gene WBGene00026568

• WormBase Gene ID: WBGene00026568
• Gene Name: Cbr-cfi-1
• Sequence Name: CBG03778
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity. Is an ortholog of C. elegans cfi-1. In C. elegans, cfi-1 is involved in negative regulation of transcription by RNA polymerase II; neuron fate specification; and positive regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03778b.1	CBG03778b.1		[unknown]
Transcript:CBG03778a.1	CBG03778a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03778b	CBG03778b		[unknown]
CDS:CBG03778a	CBG03778a		[unknown]

0 RNAi Result

12 Allele

• WBVar00108746
• WBVar00108745
• WBVar00108744
• WBVar00108743
• WBVar00108742
• WBVar00108741
• WBVar00108740
• WBVar00108751
• WBVar00108750
• WBVar00108749
• WBVar00108748
• WBVar00108747

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066417
• Remark: Cbr-cfi-1, TCAATGGAATTACCTATCAAGGAATACTATTTGCTCAAGATGAAGCCATCTCCGAGTCTT, WBGene00026568
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region