WormMine: Gene WBGene00026572

• WormBase Gene ID: WBGene00026572
• Gene Name: Cbr-ercc-1
• Sequence Name: CBG03787
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable damaged DNA binding activity. Predicted to be involved in DNA repair. Predicted to be located in nucleus. Is an ortholog of C. elegans ercc-1. In C. elegans, ercc-1 is involved in UV-damage excision repair and base-excision repair.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03787c.1	CBG03787c.1		[unknown]
Transcript:CBG03787b.1	CBG03787b.1		[unknown]
Transcript:CBG03787b.2	CBG03787b.2		[unknown]
Transcript:CBG03787a.1	CBG03787a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03787c	CBG03787c		[unknown]
CDS:CBG03787b	CBG03787b		[unknown]
CDS:CBG03787a	CBG03787a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1056931
• Remark: Cbr-ercc-1, ACTTCTCTACCACTTCGGCACGCTTCAAGAAATTTCAACAGCTTCAGAAACTGCAATTTC, WBGene00026572
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region