WormMine: Gene WBGene00026604

• WormBase Gene ID: WBGene00026604
• Gene Name: Cbr-mom-5
• Sequence Name: CBG03824
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in cell surface receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans mom-5. In C. elegans, mom-5 is involved in several processes, including embryonic morphogenesis; neuron migration; and regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03824b.1	CBG03824b.1		[unknown]
Transcript:CBG03824a.1	CBG03824a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03824b	CBG03824b		[unknown]
CDS:CBG03824a	CBG03824a		[unknown]

0 RNAi Result

1 Allele

• WBVar00017704

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1051553
• Remark: Cbr-mom-5, GCAATCTGGGTCGTTTCCTCGAAAACACTATCCAGCTATCACAAAGCTTATCTAGCTCTG, WBGene00026604
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region