WormMine: Gene WBGene00026646

• WormBase Gene ID: WBGene00026646
• Gene Name: Cbr-cdk-7
• Sequence Name: CBG03876
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and RNA polymerase II CTD heptapeptide repeat kinase activity. Predicted to be part of transcription factor TFIIK complex. Is an ortholog of C. elegans cdk-7. In C. elegans, cdk-7 is involved in mRNA transcription and mitotic cell cycle, embryonic.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03876.1	CBG03876.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03876	CBG03876		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061648
• Remark: Cbr-cdk-7, AGCCGTACTGTTGTCTGGATGAAGAACTTCCACTTCCGAATAAAAAACCCGCGAAGAGAA, WBGene00026646
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region