WormMine: Gene WBGene00026677

• WormBase Gene ID: WBGene00026677
• Gene Name: Cbr-sesn-1
• Sequence Name: CBG03915
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in regulation of response to reactive oxygen species. Predicted to be located in nucleus. Is an ortholog of C. elegans sesn-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03915.1	CBG03915.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03915	CBG03915		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051093
• Remark: CBG03915, ACCCGTGCCGTTTGCAACTACAATGCAATGTGCCTGTCCAAGAAAGGATGGAAGAAACCA, WBGene00026677
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region