WormMine: Gene WBGene00026685

• WormBase Gene ID: WBGene00026685
• Gene Name: Cbr-unc-94
• Sequence Name: CBG03923
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable tropomyosin binding activity. Predicted to be involved in pointed-end actin filament capping. Is an ortholog of C. elegans unc-94. In C. elegans, unc-94 is involved in several processes, including myofibril assembly; nematode larval development; and pointed-end actin filament capping.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03923a.2	CBG03923a.2		[unknown]
Transcript:CBG03923a.1	CBG03923a.1		[unknown]
Transcript:CBG03923b.1	CBG03923b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03923a	CBG03923a		[unknown]
CDS:CBG03923b	CBG03923b		[unknown]

0 RNAi Result

5 Allele

• WBVar00136092
• WBVar00136093
• WBVar00136094
• WBVar00136095
• WBVar00136096

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059218
• Remark: Cbr-unc-94, CAAATTGCTTCGATCTACTCTAGTGACACAGTCGATTGTGGAATTCAAGGCAGACAACCA, WBGene00026685
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region