WormMine: Gene WBGene00026754

• WormBase Gene ID: WBGene00026754
• Gene Name: Cbr-cps-6
• Sequence Name: CBG04002
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable hydrolase activity; metal ion binding activity; and nucleic acid binding activity. Is an ortholog of C. elegans cps-6. In C. elegans, cps-6 is involved in RNA catabolic process and apoptotic DNA fragmentation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04002.1	CBG04002.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04002	CBG04002		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069619
• Remark: Cbr-cps-6, GACCTCTTTATCTCCCGAAGTTGGAAGGAGATGGAAGAAAGTACATCAAGTACCAAGTGA, WBGene00026754
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region