WormMine: Gene WBGene00026774

• WormBase Gene ID: WBGene00026774
• Gene Name: Cbr-stam-1
• Sequence Name: CBG04026
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable phosphatidylinositol binding activity and ubiquitin binding activity. Is an ortholog of C. elegans stam-1. In C. elegans, stam-1 is involved in several processes, including ephrin receptor signaling pathway; protein localization to non-motile cilium; and response to hermaphrodite contact.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04026b.1	CBG04026b.1		[unknown]
Transcript:CBG04026a.1	CBG04026a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04026a	CBG04026a		[unknown]
CDS:CBG04026b	CBG04026b		[unknown]

0 RNAi Result

11 Allele

• WBVar00108933
• WBVar00108932
• WBVar00108931
• WBVar00108930
• WBVar00108929
• WBVar00108928
• WBVar00108938
• WBVar00108937
• WBVar00108936
• WBVar00108935
• WBVar00108934

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050039
• Remark: Cbr-stam-1, ATCACTTTCATTGATCGTTTCTTTGTACAAAAATCTTGTTGCGGACGGATATTCATTCAC, WBGene00026774
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region