WormMine: Gene WBGene00026778

• WormBase Gene ID: WBGene00026778
• Gene Name: Cbr-air-2
• Sequence Name: CBG04030
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans air-2. In C. elegans, air-2 is involved in several processes, including chromosome condensation; regulation of actomyosin contractile ring contraction; and spindle midzone assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04030.1	CBG04030.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04030	CBG04030		[unknown]

0 RNAi Result

4 Allele

• WBVar00001197
• WBVar00001192
• WBVar00001207
• WBVar00001202

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053616
• Remark: Cbr-air-2, AACCGCCATTTGAACACGAGAATCAAGCCGATACCTACTCTGCAATCAAAGCTGGGAGAT, WBGene00026778
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region