WormMine: Gene WBGene00026787

• WormBase Gene ID: WBGene00026787
• Gene Name: Cbr-nepr-1
• Sequence Name: CBG04041
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in positive regulation of protein dephosphorylation. Predicted to be part of Nem1-Spo7 phosphatase complex. Is an ortholog of C. elegans nepr-1. In C. elegans, nepr-1 is involved in regulation of nuclear division.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04041.1	CBG04041.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04041	CBG04041		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068353
• Remark: CBG04041, CTTTCTCCGTTCAGCCTGAGTTGTGATCACAACGGGAAACTAATTGTGAAGCCAGCAGTT, WBGene00026787
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region