WormMine: Gene WBGene00026865

• WormBase Gene ID: WBGene00026865
• Gene Name: Cbr-rme-6
• Sequence Name: CBG04130
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: VPS9 domain superfamily; Rho GTPase activation protein; GTPase-activator protein for Ras-like GTPase; Ras GTPase-activating domain; VPS9 domain; and Vacuolar sorting protein 9 (VPS9) domain. Is an ortholog of C. elegans rme-6. In C. elegans, rme-6 is involved in endocytosis; molting cycle; and regulation of clathrin-dependent endocytosis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04130.1	CBG04130.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04130	CBG04130		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062217
• Remark: Cbr-rme-6, CGAAACATTTGCTGGAGACCAAATTGAATCTGGCCGTGATGCTTACTATTGGGTTAATTT, WBGene00026865
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region