WormMine: Gene WBGene00026972

• WormBase Gene ID: WBGene00026972
• Gene Name: Cbr-smg-9
• Sequence Name: CBG04259
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in nuclear-transcribed mRNA catabolic process, nonsense-mediated decay. Is an ortholog of C. elegans smg-9. In C. elegans, smg-9 is involved in nuclear-transcribed mRNA catabolic process, nonsense-mediated decay.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04259.1	CBG04259.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04259	CBG04259		[unknown]

0 RNAi Result

5 Allele

• WBVar00001422
• WBVar00001407
• WBVar00001402
• WBVar00001417
• WBVar00001412

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069342
• Remark: Cbr-smg-9, AATGAGTTTGATGAGCATATTGCTCAGCTTAGAGTCATGTTGCAGAGGAATCGAGACGAT, WBGene00026972
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region