WormMine: Gene WBGene00027004

• WormBase Gene ID: WBGene00027004
• Gene Name: Cbr-asfl-1
• Sequence Name: CBG04296
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable histone binding activity. Predicted to be involved in nucleosome assembly and nucleosome disassembly. Predicted to be located in nucleus. Is an ortholog of C. elegans asfl-1. In C. elegans, asfl-1 is involved in DNA replication; gamete generation; and regulation of brood size.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04296.1	CBG04296.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04296	CBG04296		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055038
• Remark: Cbr-unc-85, GCAAATACAACGAGCAGGAGTTCATCAACATGGGATGGTTCGTCGCCAACGAGTACACCG, WBGene00027004
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region