WormMine: Gene WBGene00027024

• WormBase Gene ID: WBGene00027024
• Gene Name: Cbr-sra-31
• Sequence Name: CBG04323
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Is an ortholog of C. elegans sra-31.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04323b.1	CBG04323b.1		[unknown]
Transcript:CBG04323a.1	CBG04323a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04323a	CBG04323a		[unknown]
CDS:CBG04323b	CBG04323b		[unknown]

0 RNAi Result

6 Allele

• WBVar00001787
• WBVar00001767
• WBVar00001762
• WBVar00001782
• WBVar00001777
• WBVar00001772

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054117
• Remark: Cbr-sra-31, ACAAAAGCCGTGTGCATTATCATTGTCTCTCAAACTGCATGTCTTGTTATCACTGCCACT, WBGene00027024
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region