WormMine: Gene WBGene00027051

• WormBase Gene ID: WBGene00027051
• Gene Name: CBG04359
• Sequence Name: CBG04359
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to be involved in small GTPase-mediated signal transduction. Is an ortholog of C. elegans F22G12.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04359b.1	CBG04359b.1		[unknown]
Transcript:CBG04359a.1	CBG04359a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04359b	CBG04359b		[unknown]
CDS:CBG04359a	CBG04359a		[unknown]

0 RNAi Result

69 Allele

• WBVar00109201
• WBVar00109202
• WBVar00109203
• WBVar00109204
• WBVar00109205
• WBVar00109206
• WBVar00109207
• WBVar00109208
• WBVar00109200
• WBVar00109212
• WBVar00109213
• WBVar00109214
• WBVar00109215
• WBVar00109216
• WBVar00109217
• WBVar00109218
• WBVar00109219
• WBVar00109210
• WBVar00109211
• WBVar00109209
• WBVar00109223
• WBVar00109224
• WBVar00109225
• WBVar00109220
• WBVar00109221
• WBVar00109222
• WBVar00109198
• WBVar00109199
• WBVar00002257
• WBVar00002262

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053960
• Remark: CBG04359, CAATTGGCCATCGAAGCGAATGCGTCAGCGATCGGTTCTGATCAACAGACGTATCATGAA, WBGene00027051
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region