WormMine: Gene WBGene00027081

• WormBase Gene ID: WBGene00027081
• Gene Name: Cbr-rad-51
• Sequence Name: CBG04405
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP hydrolysis activity; catalytic activity, acting on DNA; and organic cyclic compound binding activity. Predicted to be involved in double-strand break repair via homologous recombination and mitotic recombination-dependent replication fork processing. Is an ortholog of C. elegans rad-51. In C. elegans, rad-51 is involved in several processes, including intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator; meiotic chromosome condensation; and negative regulation of apoptotic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04405.1	CBG04405.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04405	CBG04405		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1065008
• Remark: Cbr-rad-51, ATCGCCAAATCTTCCAGAAGCTGAGGCAACCTACTCAATCACCAATCATGGAATCGAGGA, WBGene00027081
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region