WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00027146 Gene Name  Cbr-vab-3
Sequence Name  ? CBG04483 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans vab-3. In C. elegans, vab-3 is involved in several processes, including male anatomical structure morphogenesis; negative regulation of distal tip cell migration; and positive regulation of glial cell differentiation. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG04483b.1 CBG04483b.1   [unknown]
Transcript:CBG04483a.1 CBG04483a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG04483a CBG04483a   [unknown]
CDS:CBG04483b CBG04483b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-vab-3, TAAGCCACAGCCAAATGCACGAGCTCAACGACATTGCACAAGTCCATGAGCACTACTGGA, WBGene00027146   Expr1054642 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG04481, CCTAAACCCGTTTGTTCCCGCAGCCCCACTAGAAGCCAAAAAAGAAGAGGACGACTACAT, WBGene00027145   Expr1069802 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region