WormMine: Gene WBGene00027167

• WormBase Gene ID: WBGene00027167
• Gene Name: CBG04516
• Sequence Name: CBG04516
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and nucleobase-containing compound kinase activity. Predicted to be involved in nucleobase-containing compound metabolic process. Is an ortholog of C. elegans F13E6.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04516e.1	CBG04516e.1		[unknown]
Transcript:CBG04516d.1	CBG04516d.1		[unknown]
Transcript:CBG04516c.1	CBG04516c.1		[unknown]
Transcript:CBG04516b.1	CBG04516b.1		[unknown]
Transcript:CBG04516a.1	CBG04516a.1		[unknown]

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04516a	CBG04516a		[unknown]
CDS:CBG04516d	CBG04516d		[unknown]
CDS:CBG04516e	CBG04516e		[unknown]
CDS:CBG04516b	CBG04516b		[unknown]
CDS:CBG04516c	CBG04516c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051258
• Remark: CBG04516, TGACCCAGAAGCGGTTCGTGCAAGAATGGAGTATTTCAAAAAGAACACGCTCCCAATGCT, WBGene00027167
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region