WormMine: Gene WBGene00027182

• WormBase Gene ID: WBGene00027182
• Gene Name: Cbr-gcy-14
• Sequence Name: CBG04537
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable guanylate cyclase activity and protein kinase activity. Predicted to be involved in cGMP biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-14. In C. elegans, gcy-14 is involved in several processes, including response to alkaline pH; response to lithium ion; and response to salt.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04537.1	CBG04537.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04537	CBG04537		[unknown]

0 RNAi Result

3 Allele

• WBVar00003217
• WBVar00003222
• WBVar00003212

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060372
• Remark: Cbr-gcy-14, ATTTTCGAGTACAACACTTGCCTGCTGAAAGAATCAATTTAAGAATTGGAATCAATTGTG, WBGene00027182
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region