WormMine: Gene WBGene00027205

• WormBase Gene ID: WBGene00027205
• Gene Name: Cbr-hsp-90
• Sequence Name: CBG04560
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable several functions, including ATP binding activity; ATP hydrolysis activity; and ATP-dependent protein folding chaperone. Predicted to be involved in protein folding. Is an ortholog of C. elegans hsp-90. In C. elegans, hsp-90 is involved in several processes, including determination of adult lifespan; protein export from nucleus; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04560.1	CBG04560.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04560	CBG04560		[unknown]

0 RNAi Result

1 Allele

• WBVar00003342

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG
	C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1065311
• Remark: Cbr-daf-21, GAGGAGCCACAATCCCACGCTTCCCGCATCTACAGAATGATCAAGCTTGGTCTCGATATT, WBGene00027205
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region