WormMine: Gene WBGene00027212

• WormBase Gene ID: WBGene00027212
• Gene Name: Cbr-rfc-1
• Sequence Name: CBG04569
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable several functions, including ATP binding activity; ATP hydrolysis activity; and DNA clamp loader activity. Predicted to be involved in DNA repair and DNA replication. Predicted to be part of DNA replication factor C complex. Is an ortholog of C. elegans rfc-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04569.1	CBG04569.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04569	CBG04569		[unknown]

0 RNAi Result

20 Allele

• WBVar00109520
• WBVar00109521
• WBVar00109522
• WBVar00109523
• WBVar00109524
• WBVar00109525
• WBVar00109526
• WBVar00109527
• WBVar00109519
• WBVar00109531
• WBVar00109532
• WBVar00109533
• WBVar00109534
• WBVar00109535
• WBVar00109536
• WBVar00109537
• WBVar00109538
• WBVar00109530
• WBVar00109528
• WBVar00109529

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057102
• Remark: Cbr-rfc-1, CAGAATGCTACCGTACTCGATTGATGACGTGGCAAAAGGAAAGCGGAAGGGAGTGAATGC, WBGene00027212
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region