WormMine: Gene WBGene00027224

• WormBase Gene ID: WBGene00027224
• Gene Name: Cbr-gar-3
• Sequence Name: CBG04581
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled acetylcholine receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in plasma membrane. Is an ortholog of C. elegans gar-3. In C. elegans, gar-3 is involved in several processes, including G protein-coupled acetylcholine receptor signaling pathway; positive regulation of acetylcholine secretion, neurotransmission; and positive regulation of protein localization to synapse.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04581.1	CBG04581.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04581	CBG04581		[unknown]

0 RNAi Result

4 Allele

• WBVar00109553
• WBVar00109554
• WBVar00109555
• WBVar00051809

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054245
• Remark: Cbr-gar-3, ATCCTCCGTTGTAAATTCAAAGCTGAACGACCCACAATCAATCAAGGATACGTTCGACGA, WBGene00027224
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region