WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00027230 Gene Name  Cbr-hda-1
Sequence Name  ? CBG04588 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable histone deacetylase activity. Expressed in anchor cell; anterior ganglion; hypodermis; neurons; and vulva. Is an ortholog of C. elegans hda-1. In C. elegans, hda-1 is involved in several processes, including developmental process involved in reproduction; negative regulation of signal transduction; and regulation of transcription by RNA polymerase II. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG04588.1 CBG04588.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG04588 CBG04588   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Expression of gfp in sEx13706 animals is directed by a 2.8 kb hda-1 regulatory region that includes the open reading frames and potential cis-regulatory elements(enhancers) of two other hda-1 upstream genes (ril-1 and C53A5.2). The other hda-1::gfp transgenic strain (bhEx72), generated in this study, contains a much smaller 5'upstream region of hda-1 (approximately 1.0 kb, pGLC44) and excludes the two genes mentioned above. The analysis of GFP fluorescence in sEx13706 and bhEx72 animals revealed a similar pattern, although the fluorescence in sEx13706 was much brighter.   Expr11137 hda-1 is broadly expressed throughout development. The earliest expression was detected in gastrulating embryos. The larvae exhibited GFP expression in several neuronal and epidermal cells, primarily in the anterior ganglion and ventral hypodermal regions. Expression persisted in many cells in later larval and adult stages (data not shown). In the vulva, hda-1::gfp expression was first detected in the progeny of P(5-7).p in mid-L3 animals. At this stage, GFP fluorescence was absent in other VPC lineages (P3.p, P4.p and P8.p) (data not shown). By the L4 stage, almost all vulval cell types were observed fluorescing, with presumptive vulA, vulB1, vulB2, and vulD cells being the brightest. GFP fluorescence in vulval cells was mostly absent beyond the late-L4 stage, suggesting that hda-1 may not be needed in vulval cells at later stages of development. The broad expression of hda-1 is in consistent with the involvement of the gene in multiple developmental processes. This multifaceted role for hda-1in C. elegans appears to be conserved in C. briggsae, because Cbr-hda-1::gfp is expressed in a similar manner. hda-1::gfp expression was also observed in the AC in L3 animals that persisted until the early L4 stage (data not shown). No expression was observed in pi cells or their progeny at any developmental stage.  
Cbr-hda-1, AGGTCGCAAATGAGTTGCCATACAATGACTATTTTGAGTACTTCGGACCAAATTACCGTC, WBGene00027230   Expr1055526 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region