Genomics
2 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG04632a.1 | CBG04632a.1 | [unknown] | |
Transcript:CBG04632b.1 | CBG04632b.1 | [unknown] |
Other
2 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:CBG04632b | CBG04632b | [unknown] | |
CDS:CBG04632a | CBG04632a | [unknown] |
2 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L4_vs_embryo_upregulated | |
C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L1_vs_embryo_upregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Cbr-vha-13, AAGCCAAGATTCGCAAGGACTACGATGATCTGGCTGAGGCTATGGCTAACGGTTTCAGAA, WBGene00027269 | Expr1068168 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
6 GO Annotation
Annotation Extension | Qualifier |
---|---|
enables | |
enables | |
enables | |
involved_in | |
involved_in | |
part_of |