WormMine: Gene WBGene00027356

• WormBase Gene ID: WBGene00027356
• Gene Name: Cbr-atfs-1
• Sequence Name: CBG04740
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans atfs-1. In C. elegans, atfs-1 is involved in positive regulation of nematode larval development; regulation of gene expression; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04740a.1	CBG04740a.1		[unknown]
Transcript:CBG04740b.1	CBG04740b.1		[unknown]
Transcript:CBG04740c.1	CBG04740c.1		[unknown]
Transcript:CBG04740d.1	CBG04740d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04740b	CBG04740b		[unknown]
CDS:CBG04740a	CBG04740a		[unknown]
CDS:CBG04740d	CBG04740d		[unknown]
CDS:CBG04740c	CBG04740c		[unknown]

0 RNAi Result

7 Allele

• cbp40065
• cbp40066
• WBVar00109652
• WBVar00109653
• WBVar00109654
• WBVar00020659
• WBVar00020664

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065935
• Remark: CBG04740, GATAGAAGACGTGCGCTGAATCGAATCGCAGCGGTTAGGTATCGAGAGAAGAAGCGAGCT, WBGene00027356
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region