WormMine: Gene WBGene00027447

• WormBase Gene ID: WBGene00027447
• Gene Name: CBG04847
• Sequence Name: CBG04847
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans nhr-291; nhr-269; and nhr-248.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04847b.1	CBG04847b.1		[unknown]
Transcript:CBG04847a.1	CBG04847a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04847a	CBG04847a		[unknown]
CDS:CBG04847b	CBG04847b		[unknown]

0 RNAi Result

6 Allele

• WBVar00036939
• WBVar00036934
• WBVar00036949
• WBVar00036944
• WBVar00036959
• WBVar00036954

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1065395
• Remark: CBG04847, TCTGTGCTTTTTAATATTTCCAACTTTGATTCCTTCATCAAAAACTGTCTTGTTTCCTGA, WBGene00027447
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region