WormMine: Gene WBGene00027448

• WormBase Gene ID: WBGene00027448
• Gene Name: CBG04848
• Sequence Name: CBG04848
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein kinase activity.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04848.1	CBG04848.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04848	CBG04848		[unknown]

0 RNAi Result

68 Allele

• WBVar00037149
• WBVar00037154
• WBVar00037159
• WBVar00037169
• WBVar00037164
• WBVar00037179
• WBVar00037174
• WBVar00037109
• WBVar00037104
• WBVar00037114
• WBVar00037119
• WBVar00037124
• WBVar00037129
• WBVar00037134
• WBVar00037139
• WBVar00037144
• WBVar00037079
• WBVar00037074
• WBVar00037089
• WBVar00037084
• WBVar00037099
• WBVar00037094
• WBVar00037029
• WBVar00037034
• WBVar00037039
• WBVar00037044
• WBVar00037049
• WBVar00037059
• WBVar00037054
• WBVar00037069

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063735
• Remark: CBG04848, GATGTTGGGATTGGGAACCGGAAAAGCGTCCATCATTTGACGAATGTGAACAATATTTCA, WBGene00027448
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region