WormMine: Gene WBGene00027503

• WormBase Gene ID: WBGene00027503
• Gene Name: CBG04911
• Sequence Name: CBG04911
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable chitin binding activity. Predicted to be involved in carbohydrate metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04911.1	CBG04911.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04911	CBG04911		[unknown]

0 RNAi Result

31 Allele

• WBVar00046937
• WBVar00046932
• WBVar00046947
• WBVar00046942
• WBVar00046957
• WBVar00046952
• WBVar00046962
• WBVar00046967
• WBVar00046927
• WBVar00046972
• WBVar00046977
• WBVar00046992
• WBVar00046982
• WBVar00046987
• WBVar00046997
• WBVar00047077
• WBVar00047072
• WBVar00047032
• WBVar00047027
• WBVar00047042
• WBVar00047047
• WBVar00047037
• WBVar00047052
• WBVar00047057
• WBVar00047062
• WBVar00047067
• WBVar00047002
• WBVar00047012
• WBVar00047007
• WBVar00047022

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060087
• Remark: CBG04911, AATATCATGGGAACGTTGATGGAGATTGGTTGGCATGGAAAGATCTGGAAAATGGTGGAT, WBGene00027503
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region