WormMine: Gene WBGene00027634

• WormBase Gene ID: WBGene00027634
• Gene Name: Cbr-spe-8
• Sequence Name: CBG05099
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein tyrosine kinase activity. Is an ortholog of C. elegans spe-8. In C. elegans, spe-8 is involved in spermatid development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05099b.1	CBG05099b.1		[unknown]
Transcript:CBG05099a.1	CBG05099a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05099a	CBG05099a		[unknown]
CDS:CBG05099b	CBG05099b		[unknown]

0 RNAi Result

4 Allele

• WBVar00109929
• v152
• v159
• v144

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063830
• Remark: Cbr-spe-8, CGGAGTTTGTGAAGGCCATATTTGAACAAAGCCGACTTTATGACACGGAGCAGAGAATCA, WBGene00027634
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region