WormMine: Gene WBGene00027651

• WormBase Gene ID: WBGene00027651
• Gene Name: Cbr-nas-30
• Sequence Name: CBG05121
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metalloendopeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans nas-30.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05121a.1	CBG05121a.1		[unknown]
Transcript:CBG05121b.1	CBG05121b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05121a	CBG05121a		[unknown]
CDS:CBG05121b	CBG05121b		[unknown]

0 RNAi Result

12 Allele

• WBVar00109982
• WBVar00109983
• WBVar00109984
• WBVar00109985
• WBVar00109986
• WBVar00109987
• WBVar00109988
• WBVar00109989
• WBVar00109993
• WBVar00109990
• WBVar00109991
• WBVar00109992

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1068569
• Remark: Cbr-nas-30, TCACCGAGCTACGGTATCAGTGTGCGACGTCATGCAAAGCTTATATCGAGATTAAGCATA, WBGene00027651
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region