WormMine: Gene WBGene00027671

• WormBase Gene ID: WBGene00027671
• Gene Name: Cbr-hgap-1
• Sequence Name: CBG05152
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTPase activator activity. Predicted to be involved in regulation of small GTPase mediated signal transduction. Predicted to be located in nucleus. Is an ortholog of C. elegans hgap-1. In C. elegans, hgap-1 is involved in determination of adult lifespan.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05152.1	CBG05152.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05152	CBG05152		[unknown]

0 RNAi Result

12 Allele

• WBVar00110058
• WBVar00110059
• WBVar00110056
• WBVar00110057
• WBVar00110048
• WBVar00110049
• WBVar00110050
• WBVar00110051
• WBVar00110054
• WBVar00110055
• WBVar00110052
• WBVar00110053

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051619
• Remark: CBG05152, GAATTATCGAAAAGTCTACACTCGGGAGACGATTGCCACGAAATTCTGTGATGTTCTGAT, WBGene00027671
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region