WormMine: Gene WBGene00027867

• WormBase Gene ID: WBGene00027867
• Gene Name: Cbr-bicd-1
• Sequence Name: CBG05413
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable cytoskeletal anchor activity and dynein complex binding activity. Is an ortholog of C. elegans bicd-1. In C. elegans, bicd-1 is involved in regulation of dendrite morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05413.1	CBG05413.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05413	CBG05413		[unknown]

0 RNAi Result

1 Allele

• WBVar00015299

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057194
• Remark: Cbr-bicd-1, CTCTCCCTAACTCAACGATTGGAAGATGTAGAAGTGGATAGAGATAGGCAGGCTTTTAAG, WBGene00027867
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region