WormMine: Gene WBGene00027947

• WormBase Gene ID: WBGene00027947
• Gene Name: Cbr-unc-77
• Sequence Name: CBG05508
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable monoatomic cation channel activity. Predicted to be involved in monoatomic ion transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans unc-77. In C. elegans, unc-77 is involved in positive regulation of GABAergic synaptic transmission; positive regulation of cholinergic synaptic transmission; and positive regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05508a.1	CBG05508a.1		[unknown]
Transcript:CBG05508c.1	CBG05508c.1		[unknown]
Transcript:CBG05508b.1	CBG05508b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05508a	CBG05508a		[unknown]
CDS:CBG05508b	CBG05508b		[unknown]
CDS:CBG05508c	CBG05508c		[unknown]

0 RNAi Result

5 Allele

• WBVar00110642
• WBVar00110645
• WBVar00110643
• WBVar00110644
• WBVar00023249

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050144
• Remark: Cbr-nca-1, CCATCGACACAGGGAAGCCCGAGACCACTGATGCCGAGTGAAACTACAAAAGATATAGAA, WBGene00027947
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region