WormMine: Gene WBGene00027971

• WormBase Gene ID: WBGene00027971
• Gene Name: Cbr-hif-1
• Sequence Name: CBG05540
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans hif-1. In C. elegans, hif-1 is involved in several processes, including determination of adult lifespan; positive regulation of transcription by RNA polymerase II; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05540.1	CBG05540.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05540	CBG05540		[unknown]

0 RNAi Result

10 Allele

• WBVar00040304
• WBVar00005427
• WBVar00005432
• WBVar00005422
• WBVar00110653
• WBVar00110656
• WBVar00110654
• WBVar00110655
• WBVar00011979
• WBVar00011984

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066747
• Remark: Cbr-hif-1, ACGAATGCACATGAGTGGTCCCTCCGATATGGACTACAATATGTACAATAATCAGTATCA, WBGene00027971
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region