WormMine: Gene WBGene00028044

• WormBase Gene ID: WBGene00028044
• Gene Name: Cbr-mlt-11
• Sequence Name: CBG05636
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable serine-type endopeptidase inhibitor activity. Is an ortholog of C. elegans mlt-11. In C. elegans, mlt-11 is involved in cuticle development involved in collagen and cuticulin-based cuticle molting cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

8 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05636a.1	CBG05636a.1		[unknown]
Transcript:CBG05636c.1	CBG05636c.1		[unknown]
Transcript:CBG05636b.1	CBG05636b.1		[unknown]
Transcript:CBG05636e.1	CBG05636e.1		[unknown]
Transcript:CBG05636d.1	CBG05636d.1		[unknown]
Transcript:CBG05636g.1	CBG05636g.1		[unknown]
Transcript:CBG05636f.1	CBG05636f.1		[unknown]
Transcript:CBG05636h.1	CBG05636h.1		[unknown]

Other

8 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05636e	CBG05636e		[unknown]
CDS:CBG05636d	CBG05636d		[unknown]
CDS:CBG05636g	CBG05636g		[unknown]
CDS:CBG05636f	CBG05636f		[unknown]
CDS:CBG05636h	CBG05636h		[unknown]
CDS:CBG05636a	CBG05636a		[unknown]
CDS:CBG05636c	CBG05636c		[unknown]
CDS:CBG05636b	CBG05636b		[unknown]

0 RNAi Result

2 Allele

• WBVar00005722
• WBVar00005727

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057695
• Remark: Cbr-mlt-11, GAGACACCAACCCGTACGAATCTCCAATACTTCTACTCGCCACGTGACAATCGATGCAAA, WBGene00028044
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region