WormMine: Gene WBGene00028053

• WormBase Gene ID: WBGene00028053
• Gene Name: Cbr-par-4
• Sequence Name: CBG05647
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans par-4. In C. elegans, par-4 is involved in several processes, including asymmetric protein localization involved in cell fate determination; cell division; and determination of adult lifespan.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05647.1	CBG05647.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05647	CBG05647		[unknown]

0 RNAi Result

1 Allele

• WBVar00005732

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051048
• Remark: Cbr-par-4, ATATCAAGCCAGGAAACTTGCTGCTTTCCATTGATATGACTGTTAAGATTTGTGATTTCG, WBGene00028053
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region