Genomics
3 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG05663a.2 | CBG05663a.2 | [unknown] | |
| Transcript:CBG05663a.1 | CBG05663a.1 | [unknown] | |
| Transcript:CBG05663b.1 | CBG05663b.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG05663a | CBG05663a | [unknown] | |
| CDS:CBG05663b | CBG05663b | [unknown] |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_downregulated | |
| Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-htz-1(gu167)_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG05663, TCATAATGTTTCTGGTCACAAATTCAAAGCAGTCCTTCTTCCTCAACCATGCTTCTGTTC, WBGene00028068 | Expr1066547 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
