WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028072 Gene Name  CBG05668
Sequence Name  ? CBG05668 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be involved in regulation of canonical Wnt signaling pathway. Is an ortholog of C. elegans Y43F8B.2. In C. elegans, Y43F8B.2 is involved in innate immune response. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG05668a.1 CBG05668a.1   [unknown]
Transcript:CBG05668b.1 CBG05668b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG05668b CBG05668b   [unknown]
CDS:CBG05668a CBG05668a   [unknown]

0 RNAi Result

3 Allele

Public Name
WBVar00005767
WBVar00005757
WBVar00005762

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
Heat shock: 34C 30min. Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. WBPaper00058955:heatshock_upregulated_CBG

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG05667, GATGCGATTGTATAATTTCCAGTCTGACTGAAGAAACACTGGAAGCCGCTCCAGATTATT, WBGene00028071   Expr1066167 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG05668, ATTGTCACCCCAGTCAGCACGCCAGCCATCGATCCGGATTTTAAGCCGGCGTTTAATTAA, WBGene00028072   Expr1065899 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region