WormMine: Gene WBGene00028154

• WormBase Gene ID: WBGene00028154
• Gene Name: Cbr-deb-1
• Sequence Name: CBG05763
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable actin filament binding activity. Predicted to be involved in cell adhesion. Is an ortholog of C. elegans deb-1. In C. elegans, deb-1 is involved in positive regulation of ovulation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05763b.1	CBG05763b.1		[unknown]
Transcript:CBG05763a.1	CBG05763a.1		[unknown]
Transcript:CBG05763d.1	CBG05763d.1		[unknown]
Transcript:CBG05763c.1	CBG05763c.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05763b	CBG05763b		[unknown]
CDS:CBG05763a	CBG05763a		[unknown]
CDS:CBG05763d	CBG05763d		[unknown]
CDS:CBG05763c	CBG05763c		[unknown]

0 RNAi Result

16 Allele

• WBVar00110982
• WBVar00110980
• WBVar00110981
• WBVar00110971
• WBVar00110972
• WBVar00110970
• WBVar00110975
• WBVar00110976
• WBVar00110973
• WBVar00110974
• WBVar00110979
• WBVar00110977
• WBVar00110978
• WBVar00110968
• WBVar00110969
• WBVar00110967

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068571
• Remark: Cbr-deb-1, AACAGTTGGTTCATAATGCTCAAAACTTGATGCAATCTGTAAAGGATGTCGTCCGTGCCG, WBGene00028154
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region